BBa_K294205 1 BBa_K294205 This is a coding sequence of heat shock protein from E.coli 2009-06-26T11:00:00Z 2015-05-08T01:11:49Z HSP15 derived from genome E.coli K12 http://biocyc.org/ECOLI/NEW-IMAGE?type=ENZYME&object=G7743-MONOMER this is a coding sequence of heat shock protein from E.coli. It regulate heat shock proteins ..... false false _397_ 0 5334 9 Not in stock false We chose this proiten because ... false Koji Sode annotation2006751 1 bidding domain range2006751 1 59 350 annotation2006747 1 hslR range2006747 1 1 402 BBa_K294205_sequence 1 atgaaagagaaacctgctgttgaggttcgactggataaatggctatgggctgcccgtttttataaaacccgcgcgctggcccgtgaaatgattgaaggcggtaaggtgcattacaacgggcagcgcagcaagccgagcaaaatcgtcgagctgaatgccacgctcactctgcgccagggaaatgacgaacgcacggtgattgtaaaggcgattactgaacagcgtcgccccgccagcgaggcagccttgctgtatgaagagactgcggaaagtgtagagaaacgcgaaaaaatggcgctggcacgtaaacttaatgccttaaccatgccgcacccggaccgacgcccggacaaaaaagagcgccgcgacctgttacgatttaaacacggcgacagtgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z