BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K294208 1 BBa_K294208 luxC gene, acyl-CoA reductase LuxC from Vibrio fischeri ES114 2010-05-21T11:00:00Z 2015-05-08T01:11:49Z I obtained this sequence from Genbank accession no Y00509. We want to build a bacterial lava lamp. This is the first gene in the luxCDABE operon. It helps to biosynthesize the luciferase substrate for endogenous production. We chose to use the Vibrio fischeri gene because we love Vibrio fischeri. false false _397_ 0 126 162 Not in stock false Added a 7xhis tag to the N terminus. I changed the stop codon to TAATAA. false Reshma Shetty annotation2069252 1 LuxC protein range2069252 1 1 243 annotation2069241 1 ATG start codon range2069241 1 1 3 BBa_K294209 1 luxC LuxC strong protein generator 2010-05-21T11:00:00Z 2015-05-08T01:11:49Z This composite part is composed of two preexisting Registry parts and a new part BBa_K294208. This protein generator is designed to overexpress luxC in E. coli. false false _397_ 0 126 162 Not in stock false I choose a strong RBS and a terminator with high efficiency. false Reshma Shetty component2069321 1 BBa_B0012 component2069315 1 BBa_J61109 component2069318 1 BBa_K294208 component2069319 1 BBa_B0010 annotation2069318 1 BBa_K294208 range2069318 1 19 261 annotation2069315 1 BBa_J61109 range2069315 1 1 12 annotation2069319 1 BBa_B0010 range2069319 1 270 349 annotation2069321 1 BBa_B0012 range2069321 1 358 398 BBa_J61109 1 BBa_J61109 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A false John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K294208_sequence 1 atgaataaatgtattccaatgataattaatggaatgattcaagattttgataattatgcatataaagaagttaaactaaataatgataatagagtaaaattatctgtcattactgaaagttcagtttcaaaaacattaaatatcaaagatagaattaatctaaatttaaatcagattgtgaattttttatataccgttggtcaacgatggaaaagtgaagaatataatcggcgacgaacctat BBa_K294209_sequence 1 aaagactggagatactagatgaataaatgtattccaatgataattaatggaatgattcaagattttgataattatgcatataaagaagttaaactaaataatgataatagagtaaaattatctgtcattactgaaagttcagtttcaaaaacattaaatatcaaagatagaattaatctaaatttaaatcagattgtgaattttttatataccgttggtcaacgatggaaaagtgaagaatataatcggcgacgaacctattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J61109_sequence 1 aaagactggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z