BBa_J61107 1 BBa_J61107 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K299804 1 BBa_K299804 Cactag - like a biobrick scar but first T changed to C. 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z Use only if the next part starts with ATG. This is a virtual part useful to anyone working with Anderson's RBS library. First nucleotide of the biobrick suffix is varies in the library. Some RBSes have T, wchich results in a regular suffix, but other hace c,G or A. This modified scar is to help in sillico assembly of the constructs that use Anderson's RBSes. This modified scar is suitable only if the next part starts with ATG false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_K299801 1 BBa_K299801 standard biobrick scar (if next sequence does NOT start with ATG) 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K299002 1 BBa_K299002 RBS measurement device J23100 J61107 GFP 2010-07-18T11:00:00Z 2015-05-08T01:11:49Z false false _419_ 0 4959 9 Not in stock true false Anna Olchowik component2077307 1 BBa_K299801 component2077306 1 BBa_E0040 component2077304 1 BBa_K299804 component2077310 1 BBa_K299801 component2077302 1 BBa_K299107 component2077308 1 BBa_B0010 component2077311 1 BBa_B0012 component2077303 1 BBa_J61107 component2077301 1 BBa_J23100 annotation2077302 1 BBa_K299107 range2077302 1 36 43 annotation2077306 1 BBa_E0040 range2077306 1 62 781 annotation2077310 1 BBa_K299801 range2077310 1 870 877 annotation2077311 1 BBa_B0012 range2077311 1 878 918 annotation2077307 1 BBa_K299801 range2077307 1 782 789 annotation2077301 1 BBa_J23100 range2077301 1 1 35 annotation2077303 1 BBa_J61107 range2077303 1 44 55 annotation2077308 1 BBa_B0010 range2077308 1 790 869 annotation2077304 1 BBa_K299804 range2077304 1 56 61 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K299804_sequence 1 cactag BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K299801_sequence 1 tactagag BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J61107_sequence 1 aaagaagagact BBa_K299002_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagaagagactcactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K299107_sequence 1 ttctagag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z