BBa_K299004 1 BBa_K299004 RBS measurement device J23100 J61127 GFP 2010-07-18T11:00:00Z 2015-05-08T01:11:49Z false false _419_ 0 4959 9 Not in stock true false Anna Olchowik component2077243 1 BBa_K299801 component2077239 1 BBa_J61127 component2077244 1 BBa_B0010 component2077237 1 BBa_J23100 component2077247 1 BBa_B0012 component2077242 1 BBa_E0040 component2077240 1 BBa_K299800 component2077238 1 BBa_K299107 component2077246 1 BBa_K299801 annotation2077238 1 BBa_K299107 range2077238 1 36 43 annotation2077244 1 BBa_B0010 range2077244 1 790 869 annotation2077247 1 BBa_B0012 range2077247 1 878 918 annotation2077242 1 BBa_E0040 range2077242 1 62 781 annotation2077240 1 BBa_K299800 range2077240 1 56 61 annotation2077246 1 BBa_K299801 range2077246 1 870 877 annotation2077237 1 BBa_J23100 range2077237 1 1 35 annotation2077239 1 BBa_J61127 range2077239 1 44 55 annotation2077243 1 BBa_K299801 range2077243 1 782 789 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K299801 1 BBa_K299801 standard biobrick scar (if next sequence does NOT start with ATG) 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_J61127 1 BBa_J61127 Ribosome Binding Site Family Member 2007-04-24T11:00:00Z 2015-08-31T01:59:49Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_K299800 1 BBa_K299800 standard biobrick scar (if next part starts with ATG) 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z standard biobrick scar (if next part starts with ATG) false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K299801_sequence 1 tactagag BBa_J61127_sequence 1 aaagagtggaac BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K299800_sequence 1 tactag BBa_K299004_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagagtggaactactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K299107_sequence 1 ttctagag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z