BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_K299801 1 BBa_K299801 standard biobrick scar (if next sequence does NOT start with ATG) 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K299025 1 BBa_K299025 RBS measurement device pT7 J61100 GFP 2010-10-15T11:00:00Z 2015-05-08T01:11:50Z false false _284_419_ 0 4959 9 It's complicated true false Anna Olchowik component2087710 1 BBa_K299801 component2087716 1 BBa_B0010 component2087719 1 BBa_B0012 component2087718 1 BBa_K299801 component2087711 1 BBa_J61100 component2087709 1 BBa_I719005 component2087714 1 BBa_E0040 component2087715 1 BBa_K299801 component2087712 1 BBa_K299802 annotation2087712 1 BBa_K299802 range2087712 1 44 49 annotation2087709 1 BBa_I719005 range2087709 1 1 23 annotation2087710 1 BBa_K299801 range2087710 1 24 31 annotation2087716 1 BBa_B0010 range2087716 1 778 857 annotation2087718 1 BBa_K299801 range2087718 1 858 865 annotation2087711 1 BBa_J61100 range2087711 1 32 43 annotation2087715 1 BBa_K299801 range2087715 1 770 777 annotation2087714 1 BBa_E0040 range2087714 1 50 769 annotation2087719 1 BBa_B0012 range2087719 1 866 906 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K299802 1 BBa_K299802 Aactag - like a biobrick scar but first T changed to A 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z This is a virtual part useful to anyone working with Anderson's RBS library. First nucleotide of the biobrick suffix is varies in the library, some RBSes have T, wchich results in a regular suffix, but other hace c,G or A. This Modified scar is to help in sillico assembly of the constructs that use Anderson's RBSes. false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_K299801_sequence 1 tactagag BBa_J61100_sequence 1 aaagaggggaca BBa_K299025_sequence 1 taatacgactcactatagggagatactagagaaagaggggacaaactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K299802_sequence 1 aactag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z