BBa_K299105 1 BBa_K299105 J23100xbaJ61100 2010-08-06T11:00:00Z 2015-05-08T01:11:50Z Distribution. J61100 is an RBS and comes in a in plasmid pSB1A2, but there is also a J23100 promoter and XbaI site in the vector before J61100 RBS. Biobrick 5' XbaI J23100 XbaI RBS Part Biobrick 3' gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctagaGAAAGAGGGGACAAactagtagcggccgctgcag "Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position." The sequence of 61100 has been copied here together with the promoter sequence and the xba site to enable accurate in silico assembly of composite parts. false false _419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_K299105_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagaggggacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z