BBa_K299112 1 BBa_K299112 [promoter].[TxbaIG].[J61100RBS].[scarA=T].[RFP] 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z virtual part for in sillico modelling false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik component2257803 1 BBa_K299107 component2257808 1 BBa_E1010 component2257804 1 BBa_J61100 component2257805 1 BBa_K299802 component2257802 1 BBa_J23100 annotation2257803 1 BBa_K299107 range2257803 1 36 43 annotation2257802 1 BBa_J23100 range2257802 1 1 35 annotation2257808 1 BBa_E1010 range2257808 1 62 767 annotation2257805 1 BBa_K299802 range2257805 1 56 61 annotation2257804 1 BBa_J61100 range2257804 1 44 55 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_K299802 1 BBa_K299802 Aactag - like a biobrick scar but first T changed to A 2010-08-10T11:00:00Z 2015-05-08T01:11:50Z This is a virtual part useful to anyone working with Anderson's RBS library. First nucleotide of the biobrick suffix is varies in the library, some RBSes have T, wchich results in a regular suffix, but other hace c,G or A. This Modified scar is to help in sillico assembly of the constructs that use Anderson's RBSes. false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_J61100_sequence 1 aaagaggggaca BBa_K299112_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagaggggacaaactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K299802_sequence 1 aactag BBa_K299107_sequence 1 ttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z