BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299200 1 BBa_K299200 J23100[promoter].K299107[xbaIG].J61100[RBS] = xbaI+G 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z false true _284_419_ 0 4959 9 Not in stock false false Anna Olchowik component2219534 1 BBa_J23100 component2219535 1 BBa_K299107 component2219536 1 BBa_J61100 annotation2219534 1 BBa_J23100 range2219534 1 1 35 annotation2219535 1 BBa_K299107 range2219535 1 36 43 annotation2219536 1 BBa_J61100 range2219536 1 44 55 BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K299200_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagaggggaca BBa_J61100_sequence 1 aaagaggggaca BBa_K299107_sequence 1 ttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z