BBa_J61107 1 BBa_J61107 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_K299307 1 BBa_K299307 J23100[promoter].K299107[TxbaIG].J61107[RBS] No b-brick scars between 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Registry. It is J61107 with part of its original vector. http://partsregistry.org/wiki/index.php?title=Part:BBa_J61107 J23100[promoter].K299107[xbaIG].J61107[RBS] = Nucleotide sequence: T+xbaI+G 'binds' promoter and RBS instead of the biobrick scar. Also be careful part J61107 is in registry as GAAAGAAGAGACT, and automattically when the B-brick suffix is added the next nucleotide generated by the registry page is 'T'. However the CORRECT J61107 sequence is: GAAAGAAGAGACT**C** (and then comes the rest of the suffix: actagt) It means that the physical sequence is different to the record in registry for J61100, currently there is no way around it, because registry does not alow changes in suffix, and generates T anyway. This part is just to enable automatic assembly of the Anderson's RBS collection in the original vector with parts cloned behind RBS. Anderson RBSes comes on PSB1A2 with additional promoter followed by T' XbaI G site and G. After this sequence the RBS is placed. The original Anderson RBSes and vector are described here. http://partsregistry.org/wiki/index.php?title=Part:BBa_J61107 false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik component2076948 1 BBa_J61107 component2076946 1 BBa_J23100 component2076947 1 BBa_K299107 annotation2076948 1 BBa_J61107 range2076948 1 44 55 annotation2076946 1 BBa_J23100 range2076946 1 1 35 annotation2076947 1 BBa_K299107 range2076947 1 36 43 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K299307_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagaagagact BBa_J61107_sequence 1 aaagaagagact BBa_K299107_sequence 1 ttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z