BBa_J61127 1 BBa_J61127 Ribosome Binding Site Family Member 2007-04-24T11:00:00Z 2015-08-31T01:59:49Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_K299327 1 BBa_K299327 J23100[promoter].K299107[TxbaIG].J61127[RBS] No b-brick scars between 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Registry. It is J61117 with part of its original vector. http://partsregistry.org/wiki/index.php?title=Part:BBa_J61127 J23100[promoter].K299107[xbaIG].J61127[RBS] = Nucleotide sequence: T+xbaI+G 'binds' promoter and RBS instead of the biobrick scar. In this case the physical DNA mathes the registry sequence. After assembly part J61117 is in registry as AAAGAGTGGAAC, The functional DNA of this RBS (part J61127) is AAAGAGTGGAAC*T*, when suffix is added, the first T of the suffix gives 'AAAGAGTGGAACT' sequence. This part is just to enable automatic in sillico assembly of the Anderson's RBS collection in the original vector with parts cloned behind RBS. Anderson RBSes comes on PSB1A2 with additional promoter followed by T' XbaI G site and G. After this sequence the RBS is placed. The original Anderson RBSes and vector are described here. http://partsregistry.org/wiki/index.php?title=Part:BBa_J61127 false false _284_419_ 0 4959 9 Not in stock false false Anna Olchowik component2076953 1 BBa_K299107 component2076952 1 BBa_J23100 component2076954 1 BBa_J61127 annotation2076952 1 BBa_J23100 range2076952 1 1 35 annotation2076954 1 BBa_J61127 range2076954 1 44 55 annotation2076953 1 BBa_K299107 range2076953 1 36 43 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_J61127_sequence 1 aaagagtggaac BBa_K299327_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagagtggaac BBa_K299107_sequence 1 ttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z