BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K299503 1 BBa_K299503 Expression vector J23100+B0033 2010-08-12T11:00:00Z 2015-05-08T01:11:50Z false false _419_ 0 7677 9 It's complicated true false Micha&#322; Lower component2077712 1 BBa_B0033 component2077710 1 BBa_J23100 annotation2077712 1 BBa_B0033 range2077712 1 44 54 annotation2077710 1 BBa_J23100 range2077710 1 1 35 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0033_sequence 1 tcacacaggac BBa_K299503_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtcacacaggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z