BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K299509 1 BBa_K299509 Expression Vector pT7+B0034 2010-08-19T11:00:00Z 2015-05-08T01:11:50Z false false _419_ 0 7677 9 In stock true false Micha&#322; Lower component2078417 1 BBa_B0034 component2078415 1 BBa_I719005 annotation2078417 1 BBa_B0034 range2078417 1 32 43 annotation2078415 1 BBa_I719005 range2078415 1 1 23 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_K299509_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z