BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K299510 1 BBa_K299510 Expression Vector pT7+J6100 2010-08-19T11:00:00Z 2015-05-08T01:11:50Z false false _419_ 0 7677 9 It's complicated true false Michał Lower component2087708 1 BBa_J61100 component2087707 1 BBa_K299107 component2087706 1 BBa_I719005 annotation2087706 1 BBa_I719005 range2087706 1 1 23 annotation2087708 1 BBa_J61100 range2087708 1 48 59 annotation2087707 1 BBa_K299107 range2087707 1 32 39 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_K299107 1 BBa_K299107 T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest) 2010-08-08T11:00:00Z 2015-05-08T01:11:50Z Anderson's RBS library (original vector). This is just to obtain accurate sequences while working with Anderson's RBS library in original vector. false false _284_419_ 0 4959 9 Not in stock false none false Anna Olchowik BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_J61100_sequence 1 aaagaggggaca BBa_K299510_sequence 1 taatacgactcactatagggagatactagagttctagagtactagagaaagaggggaca BBa_K299107_sequence 1 ttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z