BBa_K299511 1 BBa_K299511 Expression Vector pT7+J6101 2010-08-19T11:00:00Z 2015-05-08T01:11:50Z false false _419_ 0 7677 9 It's complicated true false Michał Lower component2078420 1 BBa_I719005 component2078421 1 BBa_J61101 annotation2078421 1 BBa_J61101 range2078421 1 32 43 annotation2078420 1 BBa_I719005 range2078420 1 1 23 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_J61101_sequence 1 aaagacaggacc BBa_K299511_sequence 1 taatacgactcactatagggagatactagagaaagacaggacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z