BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_J61117 1 BBa_J61117 Ribosome Binding Site Family Member 2007-04-23T11:00:00Z 2015-08-31T01:59:49Z N/A {{JCA_Arkin_RBSFamily}} false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_K299513 1 BBa_K299513 Expression Vector pT7+J6117 2010-08-19T11:00:00Z 2015-05-08T01:11:50Z false false _419_ 0 7677 9 It's complicated true false Michał Lower component2078425 1 BBa_J61117 component2078424 1 BBa_I719005 annotation2078425 1 BBa_J61117 range2078425 1 32 43 annotation2078424 1 BBa_I719005 range2078424 1 1 23 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_J61117_sequence 1 aaagacatgagt BBa_K299513_sequence 1 taatacgactcactatagggagatactagagaaagacatgagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z