BBa_K300002 1 BBa_K300002 Phasin (PhaP) - head domain 2010-10-02T11:00:00Z 2015-05-08T01:11:51Z Ralstonia eutropha genomic DNA. - false true _420_ 0 2621 9 It's complicated true It is identical to <partinfo>BBa_K208001</partinfo>, but it lacks the stop codon in order to support protein fusions. It has been designed as a head domain: The Prefix sequence is 5'-GAATTCGCGGCCGCTTCTAG-3' (RFC10 Prefix) The Suffix sequence is 5'-ACTAGTAGCGGCCGCTGCAG-3' (RFC23 Suffix) For these reasons, a tail domain or an internal domain (compatible with RFC23) are ready to be assembled downstream to create protein fusions. CONSTRUCTION METHOD: <partinfo>BBa_K208001</partinfo> (provided by iGEM HQ in pSB3K3 in RFC23 standard) was PCR-amplified/mutagenized with primers: phaP10F 5'-GCTTCTAGATGATCCTCACCCCGGAACA-3' phaPSR: 5'-GCTACTAGTGGCAGCCGTCGTCTTCTTTG-3' in order to delete the stop codon. The PCR product was ran on a 1% agarose gel, gel-extracted, cut with XbaI-SpeI and ligated with <partinfo>pSB1AK3</partinfo> (previously cut with XbaI-SpeI and dephosphorylated). Positive clones were found through digestion screening/sequencing. false Giacomo Zambianchi, Alessandro Ranieri, Manuel Lupotto, Paolo Magni annotation2081800 1 Start range2081800 1 1 3 BBa_K300002_sequence 1 atgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z