BBa_K300079 1 BBa_K300079 Phasin (PhaP) - head domain - with flexible protein domain linker downstream 2010-10-16T11:00:00Z 2015-05-08T01:11:51Z This is a head domain phasin that is ligated to a 10aa flexible protein domain linker (<partinfo>BBa_K105012</partinfo>). Phasin works as reported in <partinfo>BBa_K300002</partinfo>; while the linker has the function to improve, enhance and ease the folding of fusion proteins. false true _420_ 0 4140 9 It's complicated true false Giacomo Zambianchi, Alessandro Ranieri, Paolo Magni component2088060 1 BBa_K300002 component2088062 1 BBa_K105012 component2088061 1 BBa_K300077 annotation2088062 1 BBa_K105012 range2088062 1 583 612 annotation2088061 1 BBa_K300077 range2088061 1 577 582 annotation2088060 1 BBa_K300002 range2088060 1 1 576 BBa_K300077 1 scar RFC23 scar sequence 2010-10-16T11:00:00Z 2015-05-08T01:11:51Z RFC23 scar sequence (Silver-Silver mixed site) false true _420_ 0 4140 9 Not in stock false false Giacomo Zambianchi, Lorenzo Pasotti, Paolo Magni BBa_K300002 1 BBa_K300002 Phasin (PhaP) - head domain 2010-10-02T11:00:00Z 2015-05-08T01:11:51Z Ralstonia eutropha genomic DNA. - false true _420_ 0 2621 9 It's complicated true It is identical to <partinfo>BBa_K208001</partinfo>, but it lacks the stop codon in order to support protein fusions. It has been designed as a head domain: The Prefix sequence is 5'-GAATTCGCGGCCGCTTCTAG-3' (RFC10 Prefix) The Suffix sequence is 5'-ACTAGTAGCGGCCGCTGCAG-3' (RFC23 Suffix) For these reasons, a tail domain or an internal domain (compatible with RFC23) are ready to be assembled downstream to create protein fusions. CONSTRUCTION METHOD: <partinfo>BBa_K208001</partinfo> (provided by iGEM HQ in pSB3K3 in RFC23 standard) was PCR-amplified/mutagenized with primers: phaP10F 5'-GCTTCTAGATGATCCTCACCCCGGAACA-3' phaPSR: 5'-GCTACTAGTGGCAGCCGTCGTCTTCTTTG-3' in order to delete the stop codon. The PCR product was ran on a 1% agarose gel, gel-extracted, cut with XbaI-SpeI and ligated with <partinfo>pSB1AK3</partinfo> (previously cut with XbaI-SpeI and dephosphorylated). Positive clones were found through digestion screening/sequencing. false Giacomo Zambianchi, Alessandro Ranieri, Manuel Lupotto, Paolo Magni annotation2081800 1 Start range2081800 1 1 3 BBa_K105012 1 BBa_K105012 10 aa flexible protein domain linker 2008-10-18T11:00:00Z 2015-05-08T01:08:52Z Oligos with a yeast optimized coding for the peptide GENLYFQSGG have been ordered <br\n> The amino acide sequence corresponds to the interdomaine linker of xxx. ''paper'' This is a 10 amino acides long linker peptide which can be used to join protein domains together in a flexible way. So fusion proteins with variable DNA-binding and activation or repression domains might be assembled. <br\n> false true _253_ 0 3313 9 In stock true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. Furthermore, this coding sequence does not include a start codon.<br\n> For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). true Manuel Gersbacher, Katja Karstens BBa_K300002_sequence 1 atgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgcc BBa_K300077_sequence 1 actaga BBa_K300079_sequence 1 atgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgccactagaggtgaaaatttgtattttcaatctggtggt BBa_K105012_sequence 1 ggtgaaaatttgtattttcaatctggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z