BBa_B0046 1 NsiI NsiI restriction enzyme site (PstI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z NsiI recognition site. Digestion with NsiI generates a compatible cohesive end to PstI. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822730 1 NsiI site range1822730 1 1 6 BBa_K300980 1 BBa_K300980 BBa_K300001 construction intermediate (provided by Mr Gene) 2010-10-08T11:00:00Z 2015-05-08T01:11:51Z Mr Gene synthesis service (www.mrgene.com). This part has been provided by Mr Gene synthesis service and it has been used to construct BBa_K300001 plasmid. false false _420_ 0 2621 9 Not in stock false See <partinfo>BBa_K300001</partinfo>. false Susanna Zucca, Federica Sampietro, Paolo Magni component2084587 1 BBa_B0048 component2084588 1 BBa_M31983 component2084582 1 BBa_K300990 component2084592 1 BBa_M31992 component2084607 1 BBa_K300990 component2084604 1 BBa_K300987 component2084601 1 BBa_K300989 component2084603 1 BBa_B0045 component2084606 1 BBa_B0045 component2084590 1 BBa_B0033 component2084609 1 BBa_B0046 component2084581 1 BBa_B0047 component2084584 1 BBa_B0048 component2084585 1 BBa_K300986 annotation2084584 1 BBa_B0048 range2084584 1 15 20 annotation2084592 1 BBa_M31992 range2084592 1 90 95 annotation2084607 1 BBa_K300990 range2084607 1 1694 1701 annotation2084588 1 BBa_M31983 range2084588 1 72 77 annotation2084603 1 BBa_B0045 range2084603 1 1637 1642 annotation2084606 1 BBa_B0045 range2084606 1 1688 1693 annotation2084590 1 BBa_B0033 range2084590 1 78 88 annotation2084601 1 BBa_K300989 range2084601 1 96 1636 annotation2084585 1 BBa_K300986 range2084585 1 21 65 annotation2084609 1 BBa_B0046 range2084609 1 1702 1707 annotation2084582 1 BBa_K300990 range2084582 1 7 14 annotation2084581 1 BBa_B0047 range2084581 1 1 6 annotation2084604 1 BBa_K300987 range2084604 1 1643 1687 annotation2084587 1 BBa_B0048 range2084587 1 66 71 BBa_B0047 1 MfeI MfeI restriction enzyme site (EcoRI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z MfeI recognition site. Digestion with MfeI yields a compatible cohesive end to EcoRI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822740 1 MfeI site range1822740 1 1 6 BBa_M31992 1 SpeI SpeI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none SpeI restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_K300990 1 SbfI SbfI restriction site 2010-10-01T11:00:00Z 2015-05-08T01:11:52Z - This site can also be cut with PstI restriction enzyme. false false _420_ 0 2621 9 Not in stock false Restriction site sequence false Lorenzo Pasotti, Paolo Magni BBa_B0045 1 NheI NheI restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z NheI recognition site. Digestion with NheI generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822724 1 NheI site range1822724 1 1 6 BBa_M31983 1 EcoRI EcoRI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none EcoRI restriction enzyme site false true _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_K300989 1 KanMX(lox) [LoxP-KanMX-LoxP] excisable marker for yeast 2010-10-02T11:00:00Z 2015-05-08T01:11:52Z pUG6 vector (GenBank: AF298793.1). This cassette is to be used in yeast. It is composed by the kanMX gene from the E. coli transposon Tn903 that confers the resistance to the aminoglycoside antibiotic G418 to yeast (commonly used at 200 ug/ml working concentration). This gene is expressed by the TEF2 promoter/RBS and terminated by the TEF2 transcriptional terminator from Ashbya gossypii filamentous fungus. The cassette is flanked by two loxP sites and for this reason it can be excised with Cre/loxP mediated marker removal recombination procedure. ADVANTAGES IN GENOME ENGINEERING APPLICATIONS: This part can be used to select positive integrants in the yeast genome and then it can be eliminated through Cre/loxP procedure. This enables the engineering of yeast genome in multiple steps, always using the same dominant selection marker. false false _420_ 0 2621 9 Not in stock true The original sequence of loxP-KanMX-loxP from pUG6 vector has two NsiI restriction sites in kanR(Tn903) coding sequence and they have been removed in this part by changing codons. The TEF2 promoter has a XbaI and a PstI restriction sites, which have not been removed to avoid the change of the promoter strength. For this reason, this part is not fully compatible with RFC10 BioBrick Standard Assembly, but it can be assembled by using EcoRI-SpeI enzymes. false Lorenzo Pasotti, Giacomo Zambianchi, Federica Sampietro, Paolo Magni annotation2081363 1 A->T range2081363 1 708 708 annotation2081362 1 kanR(Tn903) range2081362 1 433 1242 annotation2081364 1 T->C range2081364 1 975 975 annotation2081367 1 kanMX cassette range2081367 1 35 1507 annotation2081365 1 TEF2 terminator (A. gossypii) range2081365 1 1243 1507 annotation2081360 1 BBa_J61046 (loxP) range2081360 1 1 34 annotation2081361 1 TEF2 (A. gossypii)+RBS range2081361 1 35 432 annotation2081366 1 BBa_J61046 (loxP) range2081366 1 1508 1541 BBa_K300987 1 HR2-GAL10 Homologous region in S288C yeast genome (GAL10 ORF) 2010-10-02T11:00:00Z 2015-05-08T01:11:52Z - - false false _420_ 0 2621 9 Not in stock true - false Susanna Zucca, Federica Sampietro, Paolo Magni BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_K300986 1 HR1-GAL1 Homologous region in S288C yeast genome (GAL1 ORF) 2010-10-02T11:00:00Z 2015-05-08T01:11:52Z - - false false _420_ 0 2621 9 Not in stock true - false Susanna Zucca, Federica Sampietro, Paolo Magni BBa_B0048 1 AvrII AvrII restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z AvrII recognition site. Digestion with AvrII generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822744 1 AvrII site range1822744 1 1 6 BBa_B0048_sequence 1 cctagg BBa_B0033_sequence 1 tcacacaggac BBa_B0046_sequence 1 atgcat BBa_K300989_sequence 1 ataacttcgtataatgtatgctatacgaagttattaggtctagagatctgtttagcttgcctcgtccccgccgggtcacccggccagcgacatggaggcccagaataccctccttgacagtcttgacgtgcgcagctcaggggcatgatgtgactgtcgcccgtacatttagcccatacatccccatgtataatcatttgcatccatacattttgatggccgcacggcgcgaagcaaaaattacggctcctcgctgcagacctgcgagcagggaaacgctcccctcacagacgcgttgaattgtccccacgccgcgcccctgtagagaaatataaaaggttaggatttgccactgaggttcttctttcatatacttccttttaaaatcttgctaggatacagttctcacatcacatccgaacataaacaaccatgggtaaggaaaagactcacgtttcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcttggttactcaccactgcgatccccggcaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcacaagcttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagtactgacaataaaaagattcttgttttcaagaacttgtcatttgtatagtttttttatattgtagttgttctattttaatcaaatgttagcgtgatttatattttttttcgcctcgacatcatctgcccagatgcgaagttaagtgcgcagaaagtaatatcatgcgtcaatcgtatgtgaatgctggtcgctatactgctgtcgattcgatactaacgccgccatccagtgtcgaaaacgagctctcgagaacccttaatataacttcgtataatgtatgctatacgaagttat BBa_B0047_sequence 1 caattg BBa_B0045_sequence 1 gctagc BBa_K300986_sequence 1 gtgtgaaccaatgtatccagcaccacctgtaaccaaaacaatttt BBa_K300990_sequence 1 cctgcagg BBa_M31983_sequence 1 gaattc BBa_K300980_sequence 1 caattgcctgcaggcctagggtgtgaaccaatgtatccagcaccacctgtaaccaaaacaattttcctagggaattctcacacaggactactagtataacttcgtataatgtatgctatacgaagttattaggtctagagatctgtttagcttgcctcgtccccgccgggtcacccggccagcgacatggaggcccagaataccctccttgacagtcttgacgtgcgcagctcaggggcatgatgtgactgtcgcccgtacatttagcccatacatccccatgtataatcatttgcatccatacattttgatggccgcacggcgcgaagcaaaaattacggctcctcgctgcagacctgcgagcagggaaacgctcccctcacagacgcgttgaattgtccccacgccgcgcccctgtagagaaatataaaaggttaggatttgccactgaggttcttctttcatatacttccttttaaaatcttgctaggatacagttctcacatcacatccgaacataaacaaccatgggtaaggaaaagactcacgtttcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcttggttactcaccactgcgatccccggcaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcacaagcttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagtactgacaataaaaagattcttgttttcaagaacttgtcatttgtatagtttttttatattgtagttgttctattttaatcaaatgttagcgtgatttatattttttttcgcctcgacatcatctgcccagatgcgaagttaagtgcgcagaaagtaatatcatgcgtcaatcgtatgtgaatgctggtcgctatactgctgtcgattcgatactaacgccgccatccagtgtcgaaaacgagctctcgagaacccttaatataacttcgtataatgtatgctatacgaagttatgctagccctgagttcaattctagcgcaaaggaattaccaagaccattggccgctagccctgcaggatgcat BBa_M31992_sequence 1 actagt BBa_K300987_sequence 1 cctgagttcaattctagcgcaaaggaattaccaagaccattggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z