BBa_G00102 1 VR Reverse BioBrick primer annealing site (VR binding site) 2006-02-03T12:00:00Z 2015-08-31T04:07:28Z This is the VR sequence to be used in construction of plasmids which include the VR primer site. It is the reverse complement of BBa_G00101. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1961229 1 VR range1961229 1 1 20 BBa_K300983 1 BBa_K300983 BBa_K300000 construction intermediate (provided by Mr Gene) 2010-10-08T11:00:00Z 2015-05-08T01:11:52Z Mr Gene synthesis service (www.mrgene.com). This part has been provided by Mr Gene synthesis service and it has been used to construct <partinfo>BBa_K300982</partinfo> plasmid. On the other hand, <partinfo>BBa_K300982</partinfo> was used to construct <partinfo>BBa_K300000</partinfo> BioBrick integrative base vector. false false _420_ 0 2621 9 Not in stock false See <partinfo>BBa_K300000</partinfo> for details about the design of this part. false Lorenzo Pasotti, Matteo Meroso, Nicolo' Politi, Paolo Magni component2084437 1 BBa_J72001 component2084452 1 BBa_B0033 component2084439 1 BBa_B0045 component2084446 1 BBa_G00100 component2084444 1 BBa_B0053 component2084464 1 BBa_B0048 component2084449 1 BBa_B0055 component2084461 1 BBa_B0062 component2084454 1 BBa_K300981 component2084450 1 BBa_M31983 component2084440 1 BBa_K300991 component2084457 1 BBa_B0054 component2084459 1 BBa_G00102 component2084442 1 BBa_B0045 component2084462 1 BBa_J72001 component2084436 1 BBa_B0048 annotation2084449 1 BBa_B0055 range2084449 1 557 634 annotation2084457 1 BBa_B0054 range2084457 1 658 726 annotation2084454 1 BBa_K300981 range2084454 1 652 657 annotation2084439 1 BBa_B0045 range2084439 1 43 48 annotation2084464 1 BBa_B0048 range2084464 1 824 829 annotation2084462 1 BBa_J72001 range2084462 1 788 823 annotation2084452 1 BBa_B0033 range2084452 1 641 651 annotation2084450 1 BBa_M31983 range2084450 1 635 640 annotation2084436 1 BBa_B0048 range2084436 1 1 6 annotation2084446 1 BBa_G00100 range2084446 1 537 556 annotation2084461 1 BBa_B0062 range2084461 1 747 787 annotation2084437 1 BBa_J72001 range2084437 1 7 42 annotation2084444 1 BBa_B0053 range2084444 1 465 536 annotation2084459 1 BBa_G00102 range2084459 1 727 746 annotation2084440 1 BBa_K300991 range2084440 1 49 458 annotation2084442 1 BBa_B0045 range2084442 1 459 464 BBa_G00100 1 VF2 Forward primer for sequencing/amplifying BioBrick parts (VF2) 2004-05-24T11:00:00Z 2015-08-31T04:07:28Z Originally named VF2, primer binds upstream of the standard BBa_MCS on biobrick vectors. false false _11_1_ 0 60 7 Not in stock false false Tom Knight annotation1934505 1 VF2 range1934505 1 1 20 BBa_J72001 1 FRT {FRT} recombination site for flp recombinase in BBb 2008-07-14T11:00:00Z 2015-05-08T01:08:26Z Later Later false false _171_ 0 483 171 Not in stock false N/A false John Anderson BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_K300981 1 PstI PstI restriction enzyme site 2010-10-08T11:00:00Z 2015-05-08T01:11:51Z none EcoRI restriction enzyme site false false _420_ 0 2621 9 Not in stock false none false Lorenzo Pasotti, Paolo Magni BBa_K300991 1 phi80 attP phi80 phage attP integration site 2010-10-01T11:00:00Z 2015-05-08T01:11:52Z - This part is equal to <partinfo>BBa_J72004</partinfo>, but it lacks the NheI restriction site (GCTAGC) at the 3' end. false false _420_ 0 2621 9 Not in stock true See <partinfo>BBa_J72004</partinfo> for more information. false Lorenzo Pasotti, Manuel Lupotto, Paolo Magni BBa_M31983 1 EcoRI EcoRI restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none EcoRI restriction enzyme site false true _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_B0048 1 AvrII AvrII restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z AvrII recognition site. Digestion with AvrII generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822744 1 AvrII site range1822744 1 1 6 BBa_B0045 1 NheI NheI restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z NheI recognition site. Digestion with NheI generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822724 1 NheI site range1822724 1 1 6 BBa_B0053 1 BBa_B0053 Terminator (His) 2004-01-29T12:00:00Z 2015-08-31T04:07:20Z Terminator from the E.coli His operon false true _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318602 1 stem_loop range318602 1 9 43 BBa_B0055 1 BBa_B0055 -- No description -- 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed upstream of multiple cloning site in new pSB series plasmids. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783311 1 identical to bacteriophage T3 range1783311 1 28 66 annotation1783301 1 stem loop from bacteriophage T3 range1783301 1 36 57 BBa_B0054 1 BBa_B0054 Transcriptional terminator 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed downstream of multiple cloning site in new pSB series plasmids. Similar to BBa_B0051. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1747359 1 stem loop range1747359 1 11 42 annotation1783342 1 identical to E. coli MG1655 between tonB and yciA range1783342 1 4 43 BBa_B0062 1 BBa_B0062 Terminator (Reverse B0052) 2004-01-29T12:00:00Z 2015-08-31T04:07:21Z Reverse of B0052, E.coli transcriptional terminator from the ribosomal RNA rrnC operon. false false _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318637 1 stem_loop range318637 1 14 33 BBa_B0033_sequence 1 tcacacaggac BBa_K300981_sequence 1 ctgcag BBa_B0045_sequence 1 gctagc BBa_J72001_sequence 1 gcgaagttcctatactttctagagaataggaacttc BBa_B0062_sequence 1 cagataaaaaaaatccttagctttcgctaaggatgatttct BBa_M31983_sequence 1 gaattc BBa_B0055_sequence 1 aaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaa BBa_B0048_sequence 1 cctagg BBa_B0054_sequence 1 attagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggg BBa_K300991_sequence 1 catgggcccgtgcgaatcagaaataatctcgatatcatctcttttcttgccgagcgccttcctgagctttgtgtcggtgatcattgaatgggtacacatttttgtttttgggtacacaaaagtgtacacaaagttgcccactcaaagctacacgcaatgtaacactagttcgcagagtgttatggtttacatccttgaaagcctgctggataagggtttagcgtaacagaacgtttttacgcggaattgttcgtaatatgccaaatgacaatttaagaaagtgttctaatttattagaaatttgcacttaaatcaaaaagttacggacaattcaaccaccaatcaataaattaaagggcacattaaagtacacaatatttgtgcccttctctgtttctttcccgttatca BBa_B0053_sequence 1 tccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_K300983_sequence 1 cctagggcgaagttcctatactttctagagaataggaacttcgctagccatgggcccgtgcgaatcagaaataatctcgatatcatctcttttcttgccgagcgccttcctgagctttgtgtcggtgatcattgaatgggtacacatttttgtttttgggtacacaaaagtgtacacaaagttgcccactcaaagctacacgcaatgtaacactagttcgcagagtgttatggtttacatccttgaaagcctgctggataagggtttagcgtaacagaacgtttttacgcggaattgttcgtaatatgccaaatgacaatttaagaaagtgttctaatttattagaaatttgcacttaaatcaaaaagttacggacaattcaaccaccaatcaataaattaaagggcacattaaagtacacaatatttgtgcccttctctgtttctttcccgttatcagctagctccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtttgccacctgacgtctaagaaaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaagaattctcacacaggacctgcagattagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggggctcactcaaaggcggtaatcagataaaaaaaatccttagctttcgctaaggatgatttctgcgaagttcctatactttctagagaataggaacttccctagg BBa_G00100_sequence 1 tgccacctgacgtctaagaa BBa_G00102_sequence 1 gctcactcaaaggcggtaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z