BBa_K301000 1 lone tac Tac promoter, hybrid derived from trp and lac promoters 2010-09-20T11:00:00Z 2015-05-08T01:11:52Z Constructed from synthetic oligos. Tac promoter, hybrid derived from trp and lac promoters/.////// false false _484_ 0 5136 9 It's complicated true The part is over 100 bp with prefix and suffix, therefore the oligos were designed as small fragments and then join together. false Darren Nesbeth BBa_K301000_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z