BBa_K302001 1 BBa_K302001 yneA coding sequence 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z Genomic DNA ''Bacillus subtilis'' ''Bacillus subtilis'' in response to stress such as DNA damage stops the cells from dividing. This is a part of the SOS response initiated by the accumulation of single stranded DNA from DNA damage or stalled replication. Two proteins are vital for this response: RecA and LexA. RecA forms filaments on ssDNA and promotes the autocleavage of LexA. LexA usually represses the SOS operon. ''dinR'' is homologous to ''lexA'' in ''E. coli'' and is transcribed in the opposite direction of ''yneA''. ''yneA'' stops the formation of ''ftsZ'' ring indirectly. When ''ftsZ'' forms a 30 subunit ring at the midpoint of the cell, it will contract and cause cell division. By expressing ''yneA'' and inhibiting ''ftsZ'' ring formation, the cells will grow filamentous. By inhibiting cell division, yneA allows the DNA damage genes to repair the DNA damage before continuing with the cell division cycle. It is hypothesized that yneA acts through an unknown transmembrane protein to inhibit ftsZ ring formation; we call this/these unknown components ???Blackbox proteins???. As the evidence shows expression of yneA leads to filamentation. false false _442_ 0 6014 9 Not in stock false None. false Rachel May annotation2091504 1 double stop codon range2091504 1 316 321 BBa_K302001_sequence 1 atgatcatgagtaaagaatctattatttttgtcggtctgtttacagtgattttgagcgcggttatccttatgctgtcatatacaagcagcggccaagagcttaatcagtatgttaaaatagaagtccagcaaggcgacacactctggtcaattgctgatcaggtagccgatacaaaaaagataaacaaaaatgattttattgaatgggtagctgataaaaatcaacttcaaacctctgatatccagccgggtgatgagttagtgatcccattgaaaaagaagcatcaggatgcatatgaattagcaactgtaagataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z