BBa_K302002 1 BBa_K302002 SR1 antisense RNA (L-arginine) 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z The sequence was taken from ''The small untranslated RNA SR1 from the Bacillus subtilis genome is involved in the regulation of arginine catabolism'', Heidrich et al. 2006. SR1 is an untranslated RNA which acts as the antisense to ''ahrC'' mRNA. false false _442_ 0 6009 9 Not in stock false No RBS required. false Steven Woodhouse, Alan Koh annotation2077776 1 predicted pairing range2077776 1 146 151 annotation2077778 1 predicted pairing range2077778 1 176 181 annotation2077772 1 predicted pairing range2077772 1 15 19 annotation2077774 1 predicted pairing range2077774 1 119 127 annotation2077777 1 predicted pairing range2077777 1 153 158 annotation2077775 1 predicted pairing range2077775 1 130 135 annotation2077773 1 predicted pairing range2077773 1 110 116 BBa_K302002_sequence 1 aacaaaagaaattaagcgttttcaaatttcaaagaaatggggaataagagatgggtacgattgtttgccaagattgcaacgaagccattcattactttgaagatgagaaagtgacaacattatatggaacttgctgcggacaatgtcaatgtcctgttgatgaagagtaaaaaaaagcatgcggcttaaagccgcatgctttttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z