BBa_K302003 1 BBa_K302003 P_hyperspankoid 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z Combining oid sequence (palindromic) with hyperspank. Promoter Hyperspankoid for ''B.subtilis'' adapted pspac-oid and hyperspank false false _442_ 0 6014 9 Not in stock true We used pspacoid and the spacing of the repeat from hyperspank. false Rachel May Boyd, Phil Hall and Jem Stach annotation2091499 1 oid - Lac operator range2091499 1 11 30 annotation2091500 1 oid - Lac operator range2091500 1 81 100 annotation2091501 1 pspac promoter range2091501 1 43 80 BBa_K302003_sequence 1 agaacaacctaattgtgagcgctcacaattttttgcaaaaagttgttgactttatctacaaggtgtggcataatgtgtggaattgtgagcgctcacaattaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z