BBa_K302012 1 BBa_K302012 IPTG-inducible filamentous cell formation 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z Genomic DNA from ''Bacillus subtilis'' -''yneA'' Hyperspankoid from oid and hyperspank ''Bacillus subtilis'' in response to stress such as DNA damage stops the cells from dividing. This is a part of the SOS response initiated by the accumulation of single stranded DNA from DNA damage or stalled replication. Two proteins are vital for this response: RecA and LexA. RecA forms filaments on ssDNA and promotes the autocleavage of LexA. LexA usually represses the SOS operon. ''dinR'' is homologous to lexA in ''E. coli'' and is transcribed in the opposite direction of ''yneA''. ''yneA'' stops the formation of ''ftsZ'' ring indirectly. When ''ftsZ'' forms a 30 subunit ring at the midpoint of the cell, it will contract and cause cell division. By expressing ''yneA'' and inhibiting ''ftsZ'' ring formation, the cells will grow filamentous. By inhibiting cell division, ''yneA'' allows the DNA damage genes to repair the DNA damage before continuing with the cell division cycle. It is hypothesized that ''yneA'' acts through an unknown transmembrane protein to inhibit ''ftsZ'' ring formation; we call this/these unknown components ???Blackbox proteins???. As the evidence shows expression of ''yneA'' leads to filamentation. false false _442_ 0 6014 9 It's complicated true none false Rachel May Boyd, Phil Hall component2090495 1 BBa_K302003 component2090497 1 BBa_K302005 annotation2090497 1 BBa_K302005 range2090497 1 107 460 annotation2090495 1 BBa_K302003 range2090495 1 1 106 BBa_K302003 1 BBa_K302003 P_hyperspankoid 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z Combining oid sequence (palindromic) with hyperspank. Promoter Hyperspankoid for ''B.subtilis'' adapted pspac-oid and hyperspank false false _442_ 0 6014 9 Not in stock true We used pspacoid and the spacing of the repeat from hyperspank. false Rachel May Boyd, Phil Hall and Jem Stach annotation2091500 1 oid - Lac operator range2091500 1 81 100 annotation2091499 1 oid - Lac operator range2091499 1 11 30 annotation2091501 1 pspac promoter range2091501 1 43 80 BBa_K302005 1 BBa_K302005 yneA RBS and coding sequence 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z Genomic ''Bacillus subtilis'' ''Bacillus subtilis'' in response to stress such as DNA damage stops the cells from dividing. This is a part of the SOS response initiated by the accumulation of single stranded DNA from DNA damage or stalled replication. Two proteins are vital for this response: RecA and LexA. RecA forms filaments on ssDNA and promotes the autocleavage of LexA. LexA usually represses the SOS operon. ''dinR'' is homologous to ''lexA'' in E. coli and is transcribed in the opposite direction of yneA. yneA stops the formation of ''ftsZ'' ring indirectly. When ''ftsZ'' forms a 30 subunit ring at the midpoint of the cell, it will contract and cause cell division. By expressing ''yneA'' and inhibiting ''ftsZ'' ring formation, the cells will grow filamentous. By inhibiting cell division, yneA allows the DNA damage genes to repair the DNA damage before continuing with the cell division cycle. It is hypothesized that yneA acts through an unknown transmembrane protein to inhibit ''ftsZ'' ring formation; we call this/these unknown components ???Blackbox proteins???. As the evidence shows expression of ''yneA'' leads to filamentation. false false _442_ 0 6014 9 Not in stock false None false Rachel May Boyd, Phil Hall, Deena Tsu, Jannetta Steyn annotation2080756 1 Double stop codon range2080756 1 349 354 BBa_K302012_sequence 1 agaacaacctaattgtgagcgctcacaattttttgcaaaaagttgttgactttatctacaaggtgtggcataatgtgtggaattgtgagcgctcacaattaagcttaagccttactagagaaagaggaggtgaactactatgatcatgagtaaagaatctattatttttgtcggtctgtttacagtgattttgagcgcggttatccttatgctgtcatatacaagcagcggccaagagcttaatcagtatgttaaaatagaagtccagcaaggcgacacactctggtcaattgctgatcaggtagccgatacaaaaaagataaacaaaaatgattttattgaatgggtagctgataaaaatcaacttcaaacctctgatatccagccgggtgatgagttagtgatcccattgaaaaagaagcatcaggatgcatatgaattagcaactgtaagataataa BBa_K302003_sequence 1 agaacaacctaattgtgagcgctcacaattttttgcaaaaagttgttgactttatctacaaggtgtggcataatgtgtggaattgtgagcgctcacaattaagctt BBa_K302005_sequence 1 aagccttactagagaaagaggaggtgaactactatgatcatgagtaaagaatctattatttttgtcggtctgtttacagtgattttgagcgcggttatccttatgctgtcatatacaagcagcggccaagagcttaatcagtatgttaaaatagaagtccagcaaggcgacacactctggtcaattgctgatcaggtagccgatacaaaaaagataaacaaaaatgattttattgaatgggtagctgataaaaatcaacttcaaacctctgatatccagccgggtgatgagttagtgatcccattgaaaaagaagcatcaggatgcatatgaattagcaactgtaagataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z