BBa_K302002 1 BBa_K302002 SR1 antisense RNA (L-arginine) 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z The sequence was taken from ''The small untranslated RNA SR1 from the Bacillus subtilis genome is involved in the regulation of arginine catabolism'', Heidrich et al. 2006. SR1 is an untranslated RNA which acts as the antisense to ''ahrC'' mRNA. false false _442_ 0 6009 9 Not in stock false No RBS required. false Steven Woodhouse, Alan Koh annotation2077775 1 predicted pairing range2077775 1 130 135 annotation2077774 1 predicted pairing range2077774 1 119 127 annotation2077773 1 predicted pairing range2077773 1 110 116 annotation2077777 1 predicted pairing range2077777 1 153 158 annotation2077778 1 predicted pairing range2077778 1 176 181 annotation2077772 1 predicted pairing range2077772 1 15 19 annotation2077776 1 predicted pairing range2077776 1 146 151 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K174004 1 BBa_K174004 Pspac promoter 2009-10-09T11:00:00Z 2015-05-08T01:10:58Z This sequence is taken from pmutin4 integration vector. pmutin2's lacI binding site was changed with the "oid" sequence to create pmutin4. This promoter can be induced by IPTG. Wild type LacI binding site is replaced with a perfect palindromic "oid" operator sequence which increases the repression by LacI. This biobrick is an enhancement of Biobrick BBa_K090501 which has the sequence from pmutin2. false false _277_ 0 3942 9 Not in stock false pmutin2's genbank accession number is AF072806. Although there is no sequence information for pmutin4, it can be derived from pmutin2's sequence information by changing the O1 lacI binding site with the "oid" sequence. false The Newcastle 2009 iGEM team annotation2033093 1 oid - Lac operator range2033093 1 81 100 annotation2033094 1 pspac promoter range2033094 1 43 80 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K302013 1 BBa_K302013 IPTG-inducible L-arginine 2010-08-11T11:00:00Z 2015-05-08T01:11:52Z Synthesised.. reference paper. SR1 .. false false _442_ 0 6009 9 Not in stock true No RBS needed. false Steven Woodhouse, Alan Koh component2220654 1 BBa_K302002 component2220646 1 BBa_K174004 component2220661 1 BBa_B0014 annotation2220654 1 BBa_K302002 range2220654 1 107 312 annotation2220646 1 BBa_K174004 range2220646 1 1 106 annotation2220661 1 BBa_B0014 range2220661 1 313 407 BBa_K174004_sequence 1 agaacaacctctgctaaaattcctgaaaaattttgcaaaaagttgttgactttatctacaaggtgtggcataatgtgtggaattgtgagcgctcacaattaagctt BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K302002_sequence 1 aacaaaagaaattaagcgttttcaaatttcaaagaaatggggaataagagatgggtacgattgtttgccaagattgcaacgaagccattcattactttgaagatgagaaagtgacaacattatatggaacttgctgcggacaatgtcaatgtcctgttgatgaagagtaaaaaaaagcatgcggcttaaagccgcatgctttttat BBa_K302013_sequence 1 agaacaacctctgctaaaattcctgaaaaattttgcaaaaagttgttgactttatctacaaggtgtggcataatgtgtggaattgtgagcgctcacaattaagcttaacaaaagaaattaagcgttttcaaatttcaaagaaatggggaataagagatgggtacgattgtttgccaagattgcaacgaagccattcattactttgaagatgagaaagtgacaacattatatggaacttgctgcggacaatgtcaatgtcctgttgatgaagagtaaaaaaaagcatgcggcttaaagccgcatgctttttattcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z