BBa_K302031 1 BBa_K302031 Sucrose sensitive inducer 2010-10-24T11:00:00Z 2015-05-08T01:11:52Z ''Bacillus Subtilis'' 168 Post-promoter, pre-RBS inducer sequence from ''Bacillus Subtilis sacB'' gene that will allow coding sequence translation only when there is sucrose in the media. false false _442_ 0 6345 9 Not in stock true Selected sequence from 168 chromosome based on the work of Shimotsu, H., and Henner, D. J. (1986) ''J. Bacteriol.'' 168, 380???388 false Philip Hall annotation2099665 1 Sucrose binding loop range2099665 1 41 106 BBa_K302031_sequence 1 gaaaagtaaatcgcgcgggtttgttactgataaagcaggcaagacctaaaatgtgtaaagggcaaagtgtatactttggcgtcaccccttacatattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagtacataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z