BBa_K302033 1 BBa_K302033 mazF 2010-10-24T11:00:00Z 2015-06-01T02:27:54Z ''Bacillus Subtilis'' 168 strain Encodes a stable non-specific ribonuclease in ''Bacillus Subtilis''. It is used in conjungtion with ''mazE'' in ''Bacillus Subtilis'' to provide a toxin-antitoxin in various stressful conditions. When transcribtion of both genes is turned off (as both are under contol of same promoter) ''mazE'' will be degraded faster than ''mazF''. There is then no inhibiton of ''mazF'', killing the cell. false false _442_ 4206 6345 9 In stock false Sequence isolated based upon the work of Pellegrini, O., Mathy, N., Gogos, A., Shapiro, L., and Condon, C. (2005) The ''Bacillus subtilis'' ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor. ''Mol Microbiol'' 56: 1139???1148. false Philip Hall annotation2099798 1 double TAA added range2099798 1 334 339 BBa_K302033_sequence 1 atggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z