BBa_K302034 1 BBa_K302034 mazEF toxin-antitoxin cluster 2010-10-24T11:00:00Z 2015-05-08T01:11:52Z ''Bacillus Subtilis'' 168 strain Encodes a stable non-specific ribonuclease toxin and its inhibitory antitoxin in ''Bacillus Subtilis''. These genes are use in ''Bacillus Subtilis'' to provide a toxin-antitoxin in various stressful conditions. When transcribtion of both genes is turned off (as both are under contol of same promoter) mazE will be degraded faster than mazF. There is then no inhibiton of mazF, killing the cell. false false _442_ 0 6345 9 Not in stock false Sequence isolated based upon the work of Pellegrini, O., Mathy, N., Gogos, A., Shapiro, L., and Condon, C. (2005) The ''Bacillus subtilis'' ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor. ''Mol Microbiol'' 56: 1139???1148. false Philip Hall annotation2100097 1 K302032 range2100097 1 21 269 annotation2100129 1 K302033 range2100129 1 269 607 annotation2100096 1 mazE native RBS range2100096 1 1 20 BBa_K302034_sequence 1 agcggtttgaggaaagggttatgatccacagtagcgtaaagcgttggggaaattcaccggcggtgcggatcccggctacgttaatgcaggcgctcaatctgaatattgatgatgaagtgaagattgacctggtggatggcaaattaattattgagccagtgcgtaaagagcccgtatttacgcttgctgaactggtcaacgacatcacgccggaaaacctccacgagaatatcgactggggagagccgaaagataaggaagtctggtaatggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z