BBa_K303000 1 BBa_K303000 Ptet/ara with J23106 2010-10-23T11:00:00Z 2015-05-08T01:11:52Z The part contains the constitutive promoter, J23106. It has been modified with two new operator sites. This is a hybrid promoter. It is repressed by tetracycline and induced by arabinose. false false _424_ 0 4272 9 It's complicated true The PCR method was used to assemble the part. false Adam Bower BBa_K303000_sequence 1 agcatagcatttttatccataagattagcggatcctaagctttactccctatcagtgatagagaatagtgctagctccctatcagtgatagaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z