BBa_K303001 1 BBa_K303001 Ptet/lac with J23106 2010-10-23T11:00:00Z 2015-05-08T01:11:52Z The constitutive promoter J23106 was used to construct this part. The promoter was modified by adding two new operator sites. This part is a hybrid promoter. It is repressed by tetracycline and also repressed by lactose. false false _424_ 0 4272 9 It's complicated false The part was synthesized as linear DNA and was placed inside its vector using biobrick assembly. false Adam Bower BBa_K303001_sequence 1 agtttactccctatcagtgatagagaatagtgctagcaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z