BBa_K303002 1 BBa_K303002 Plac/ara with J23106 2010-10-23T11:00:00Z 2015-05-08T01:11:52Z The constitutive promoter J23106 was used to make this part. This part is a hybrid promoter. It is repressed by lactose and induced by arabinose. It used the constitutive promoter J23106 and was modified using two new operator sites. false false _424_ 0 4272 9 It's complicated true The part was synthesized and inserted into the plasmid using biobrick assembly. false Adam Bower BBa_K303002_sequence 1 agcatagcatttttatccataagattagcggatcctaagctttaaattgtgagcgctcacaattatagtgctagcaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z