BBa_K303003 1 BBa_K303003 Ptet/ara with J23110 2010-10-23T11:00:00Z 2015-05-08T01:11:52Z The part uses the constitutive promoter, J23110. This is a hybrid promoter. It is constructed by from the constitutive promoter, J23110. The promoter was modified using two new operator sites. The promoter is repressed by tetracycline and induced by arabinose. false false _424_ 0 4272 9 It's complicated true The part was synthesized and biobrick assembly was used to insert the part into the plasmid. false Adam Bower BBa_K303003_sequence 1 agcatagcatttttatccataagattagcggatcctaagctttactccctatcagtgatagagaacaatgctagctccctatcagtgatagaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z