BBa_K303004 1 BBa_K303004 Ptet/lac with J23110 2010-10-23T11:00:00Z 2015-05-08T01:11:52Z The constitutive promoter, J23110 was used to construct the part. This is a hybrid promoter. The part is repressed by both tetracycline and lactose. The part is made from the constitutive promoter, J23110. false false _424_ 0 4272 9 It's complicated true The part was synthesized and the biobrick assembly was used to insert the part into the plasmid. false Adam Bower BBa_K303004_sequence 1 agtttactccctatcagtgatagagaacaatgctagcaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z