BBa_K305004 1 BBa_K305004 Hydrophobic protein chaplin H (chpH) 2010-09-26T11:00:00Z 2015-05-08T01:11:53Z Ordered as construct from Mr. Gene after genomic sequence had been identified. Strongly hydrophobic protein originating from Streptomyces coelicolor and codon optimized for Bacillus subtilis. false false _426_ 0 5904 9 It's complicated false codon optimized for B. subtilis false Maarten van den Nieuwenhof, Ramon Sieber, Arend Jan Suk annotation2103009 1 Signal Sequence range2103009 1 28 101 annotation2102782 1 CDS range2102782 1 25 258 annotation2102754 1 RBS range2102754 1 12 17 BBa_K305004_sequence 1 taactagctgaaggaggagaggaaatgctgaaaaaagtggtggcggcggcggcggcgacaggcggactggttctggcaggagcgggaatggcggtggcggatagcggagcacaaggtgcagcggtacattcaccgggcgtcctgagcggaaatgttgtgcaagtcccggtacatgttcctgtgaacgtctgcggaaacacaatctcagtaatcggacttcttaaccctgcttttggaaatgtctgtatcaataaatgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z