BBa_K305007 1 BBa_K305007 srfA promoter, short variant 2010-10-17T11:00:00Z 2015-05-08T01:11:53Z none Promotor for the surfactin regulatory gene. Isolated from B.subtilis using large area around identified sequence with PCR. false false _426_ 0 5904 9 It's complicated true none false Joel Kuiper, Arend Jan Suk BBa_K305007_sequence 1 gattgaacgcagcagtttggtttaaaaatttttatttttctgtaaataatgtttagtggaaatgattgcggcatcccgcaaaaaatattgctgtaaataaactggaatctttcggcatcccgcatgaaacttttcacccatttttcggtgataaaaacatttttttcatttaaactgaacggtagaaagataaaaaatattgaaaacaatgaataaatagccaaaattggtttcttattagggtggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z