BBa_K309006 1 BBa_K309006 pSip-1 (C. elegans promoter) 2010-10-21T11:00:00Z 2015-05-08T01:11:53Z From C. elegans genomic DNA. This is a promoter for use in C. elegans chassis. false false _428_ 0 4458 9 It's complicated false The exact length and sequence of the functional sequence that acts as the promoter in C. elegans has not been elucidated. Thus this sequence is a section of genomic DNA that exists in front of the Sip-1 gene that has been previously demonstrated to function as a promoter, with the same expression pattern as the Sip-1 gene. false Chris Palmer BBa_K309006_sequence 1 attttgcgtgcaatgcatttttttaaaagaaaagcggaattttaaaacagaattgtgtgaaaaatttaattttcagagaaagattttagagaaaaaaaaatgcaaaattctgataaaaaataaataatttttattaaaatacgcaatttctcgtaaaatataatgtttgacctacattttgatctctcactgatcatcgaaacaacaacaaaaatgtaaacaagtaaacaacaacaaacaacaaacaaaaattgggtataaaaggcgcggattttgccattttcctcagacgttcatcgtttttcacctcattcttaaccctattcactcaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z