BBa_K310000 1 BBa_K310000 micA (sRNA) 2010-09-14T11:00:00Z 2015-05-08T01:11:53Z Escherichia coli MG1655 micA is a small non-coding RNA regulator that binds to the 5' UTR of OmpA via non-perfect base pairing. The primary action of micA is the translational repression of OmpA by ribosome occlusion of OmpA mRNA and subsequent destabalization of the transcript. micA binds RNA chaperone, hfq, which works to stabalize micA in the cytoplasm, accelerate sRNA-mRNA base pair annealing, recruit the RNA degradosome to the sRNA-mRNA complex. false false _429_ 0 4552 9 Not in stock true The biobrick prefix is attached just upstream of the sRNA. This leads to the addition of 8 nucleotides (scar coding) to the 5' end of the sRNA, TACTAGAG, when combined with an upstream part (ie-promoter). All sRNA's in E. coli carry an intrinsic terminator. The suffix is located ~20 bp downstream of this terminator. false Francis Lee BBa_K310000_sequence 1 gaaagacgcgcatttgttatcatcatccctgatttcagagatgaaattttggccactcacgagtggcctttttcttttctgtcaggcgtgtttttccagccacaccgcaaacggttcggtatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z