BBa_K310001 1 BBa_K310001 gadY (sRNA) 2010-09-14T11:00:00Z 2015-05-08T01:11:53Z Escherichia coli MG1655 micF is a small non-coding RNA regulator that binds to the 5' UTR of OmpF via non-perfect base pairing. The primary action of micA is the translational repression of OmpF by ribosome occlusion of OmpF mRNA and subsequent destabalization of the transcript. micF binds RNA chaperone, hfq, which works to stabalize micA in the cytoplasm, accelerate sRNA-mRNA base pair annealing, recruit the RNA degradosome to the sRNA-mRNA complex. false false _429_ 0 4552 9 It's complicated true 8 nucleotides have been added to the 5' of micF (scar coding) false Francis Lee BBa_K310001_sequence 1 actgagagcacaaagtttcccgtgccaacagggagtgttataacggtttattagtctggagacggcagactatcctcttcccggtcccctatgccgggttttttttatgtctgagtaaaactctataatcttattccttccgcagaacggtcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z