BBa_K310007 1 BBa_K310007 ArsR repressor of the Ars Operon in E. coli K-12 MG1655 2010-09-23T11:00:00Z 2015-05-08T01:11:53Z E. coli K-12 MG1655 genome ArsR is a repressor involved in regulating the Ars Operon in E. coli. This operon is used by the cell to respond to the presence of arsenic in the environment. false false _429_ 0 6020 9 It's complicated false Site directed mutagenesis was performed in the coding region of ArsR due to the presence of XbaI site. This changed the coding sequence AGATCT to AGGTCT. false Erin Borchardt BBa_K310007_sequence 1 atgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaaggtctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z