BBa_K310011 1 BBa_K310011 GolB: Gold-binding protein 2010-10-25T11:00:00Z 2015-05-08T01:11:54Z This gene is in Salmonella typhimurium LT2. This protein binds to and sequesters gold ions. false false _429_ 0 6808 9 It's complicated false This gene is in pSB1C3 with the RFC10 standard. false Thomas Hsiao BBa_K310011_sequence 1 atgcagttccatattgatgacatgacctgcggcggctgcgccagtacggtaaaaaagacgattctgactctcgatgctaatgcgacggtgagaactgacccggcgacgcgtctggttgacgttgaaacgtcgctatccgcggagcagattgccgccgccctgcaaaaggccggtttcccgccgcgcgagacctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z