BBa_K310024 1 BBa_K310024 Ptet + MicA 2010-10-26T11:00:00Z 2015-05-08T01:11:54Z e. coli k12 mg1655 coming soon false false _429_ 0 6020 9 Not in stock false coming soon false Erin Borchardt component2111881 1 BBa_R0040 component2111886 1 BBa_K252000 annotation2111886 1 BBa_K252000 range2111886 1 63 401 annotation2111881 1 BBa_R0040 range2111881 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K252000 1 BBa_K252000 MicA small RNA 2009-10-20T11:00:00Z 2015-05-08T01:11:40Z E. coli MG-1655 MicA is a regulatory small RNA. Its standard coding sequence is ligated to the lac promoter sequence (BBa_R0010)via blunt end ligation. Blunt end is necessary for function of small RNA. Restriction enzyme used for blunt end cutting is BfrBI (ATG/CAT). false false _344_ 0 3135 9 It's complicated false Attached to the lac promoter sequence (BBa_R0010) with a blunt end restriction site. Restriction enzyme used for blunt end cutting is BfrBI (ATG/CAT). false Graham Heimberg BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K310024_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacagttatatgcctttattgtcacagattttattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttttagaattggataatccttatccagagcat BBa_K252000_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacagttatatgcctttattgtcacagattttattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttttagaattggataatccttatccagagcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z