BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K310002 1 BBa_K310002 MicF (sRNA) 2010-09-14T11:00:00Z 2015-05-08T01:11:53Z Escherichia coli MG1655 micF is a small non-coding RNA regulator that binds to the 5' UTR of OmpF via non-perfect base pairing. The primary action of micA is the translational repression of OmpF by ribosome occlusion of OmpF mRNA and subsequent destabalization of the transcript. micF binds RNA chaperone, hfq, which works to stabalize micA in the cytoplasm, accelerate sRNA-mRNA base pair annealing, recruit the RNA degradosome to the sRNA-mRNA complex. false false _429_ 0 4552 9 It's complicated true 8 nucleotides have been added to the 5' of micF (scar coding) false Francis Lee BBa_K310026 1 BBa_K310026 Ptet + MicF 2010-10-26T11:00:00Z 2015-05-08T01:11:54Z e. coli k12 mg1655 coming soon false false _429_ 0 6020 9 Not in stock false coming soon false Erin Borchardt component2112003 1 BBa_K310002 component2111998 1 BBa_R0040 annotation2111998 1 BBa_R0040 range2111998 1 1 54 annotation2112003 1 BBa_K310002 range2112003 1 63 195 BBa_K310026_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcggttttttttacccttctttacacacttttcattattctgtgctaccaca BBa_K310002_sequence 1 gctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcggttttttttacccttctttacacacttttcattattctgtgctaccaca BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z