BBa_K311002 1 BBa_K311002 Constitutive lac promoter with downstream EGFP 2010-10-14T11:00:00Z 2015-05-08T01:11:54Z genomic DNA The mutations were generated to get a constitutive lac promoter. The promoter was cloned in pSB1C3 upstream to the EGFP. The promoter activity was checked by transforming the recombinant plasmid in Lac repressor negative (TOP10) and Lac repressor positive (DH5 alpha pro) E. coli cells. The recombinant cells were grown in the presence of varying concentration of inducer (IPTG) and also in the absence of the inducer. The culture was collected at different time points post induction and promoter activity was measured by measuring the fluorescence intensity under FACs. Both the cell types show constitutive behavior of the promoter. false false _430_ 0 7095 9 It's complicated false The lac and EGFP were obtained from one of our home made plasmids by digesting it with EcoR I and Pst I. The part was ligated to EcoR I and Pst I cut pSB1C3. false Ethan Johnson, Claudia Schmidt-Dannert, Poonam Srivastava, Ian Windsor annotation2086650 1 BBa_E0040 range2086650 1 20 739 annotation2086651 1 BBa_B0016 range2086651 1 748 795 annotation2086647 1 BBa_B0032 range2086647 1 1 13 annotation2086649 1 GFP protein range2086649 1 20 739 annotation2086648 1 RBS range2086648 1 7 10 annotation2086646 1 RBS-3\Weak range2086646 1 1 13 BBa_K311002_sequence 1 tgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcatcctgaacttatctagacccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcgtctagtagaaggaggagatctggatccatatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaatgcatccatggcggccgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z