BBa_K313011 1 BBa_K313011 lox2272 site for Cre recombination 2010-10-21T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in oligonucleotide form. This part is a recombination site for cre DNA recombinase. It works independently of lox66 or lox71. false false _433_ 0 5929 9 It's complicated false nothign special false Ryosuke Kamei, Ryo Kariyazono BBa_K313011_sequence 1 ataacttcgtataggatactttatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z