BBa_K313025 1 BBa_K313025 as RNA 2 2010-10-23T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of oligonucleotide. This is target sequence of asRNA BBa_K313026. false false _433_ 0 5929 9 Not in stock false Nothing special. false Ryo Kariyazono, Ryosuke Kamei, Mingshuo Zeng BBa_K313034 1 BBa_K313034 as RNA generator 2 2010-10-23T11:00:00Z 2015-05-08T01:11:54Z BBa_J23100, BBa_K313025, BBa_B0014 This part is a asRNA generator. Its target sequence is BBa_K313026. false false _433_ 0 5929 9 It's complicated false nothing special false Mingshuo Zeng, Ryo Kariyazono, Kosuke Uekusa, Ryosuke Kamei component2095908 1 BBa_J23100 component2095916 1 BBa_B0014 component2095909 1 BBa_K313025 annotation2095916 1 BBa_B0014 range2095916 1 115 209 annotation2095909 1 BBa_K313025 range2095909 1 44 106 annotation2095908 1 BBa_J23100 range2095908 1 1 35 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K313025_sequence 1 cagatgtcgccgtgtgctgacaggaaagtcctcttattacagatgtcgccgtgtgctgacagg BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_K313034_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagcagatgtcgccgtgtgctgacaggaaagtcctcttattacagatgtcgccgtgtgctgacaggtactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z