BBa_K314975 1 CapDCP CapDCP 2010-10-17T11:00:00Z 2015-05-08T01:11:55Z In-House Mutant A circularly permuted CapD using a Foldit-designed linker true false _496_ 0 6395 9 Discontinued false Foldit created linker for Circular Permutation, No Signal Sequence, Single band on protein agarose gel false God/Nature annotation2089296 1 myfeature range2089296 1 1 2 annotation2089274 1 myfeature range2089274 1 1 2 BBa_K314975_sequence 1 catctactacgactagcatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z