BBa_K314989 1 BBa_K314989 2010-10-02T11:00:00Z 2015-05-08T01:11:55Z To build the mutant proteins, we follow the path of the central dogma. First, we created DNA that contains our mutations. Second, we induced our transformed cells containing the desired DNA to express the mutant proteins. Lastly, we harvested the proteins by lysing open the cells and filtering out non-desired cell components. There are two main obstacles limiting natural CapD as an Anthrax therapeutic. First, natural CapD is a difficult to express dimer, requiring an auto-cleavage to activate. Second, CapD is a better transpeptidase than poly-????-D-glutamate hydrolase, limiting its Anthrax decapsulating potential. To solve the first problem, we created a circular permuted, monomeric version of CapD that is easy to express and quantify. To improve hydrolysis, we used FoldIt, a computational toolbox, to design active site mutations aimed to increase hydrolysis over transpeptidation. true false _496_ 0 6395 9 Discontinued false To increase the hydrolytic ability of CapD_CP, we made point mutations to the active site. We focused our attention on two types of mutations. First, we created point mutations that can establish hydrogen bondings to a modeled transition state of our substrate in an attempt to lower the activation energy, making hydrolysis more favorable. Second, we mutated the active site into a more open and polar area in an attempt to increase the ease with which water can enter and participate in a hydrolysis reaction. false annotation2081948 1 s2 range2081948 1 75 90 annotation2081950 1 rib1 range2081950 1 14 26 annotation2081949 1 mypr range2081949 1 2 12 annotation2081951 1 capd range2081951 1 30 55 annotation2081944 1 mypr range2081944 1 2 12 annotation2081954 1 mypr range2081954 1 2 12 annotation2081956 1 mypr range2081956 1 2 12 annotation2081945 1 rib1 range2081945 1 14 26 annotation2081947 1 s1 range2081947 1 60 65 annotation2081953 1 s2 range2081953 1 75 90 annotation2081955 1 mypr range2081955 1 2 12 annotation2081946 1 capd range2081946 1 30 55 annotation2081952 1 s1 range2081952 1 60 65 BBa_K314989_sequence 1 ttttcgggctcgcgtctgagagggaaaggctgcggctaggcatacgtactgacgatcgtacgcggcgctcccttttcgggctcgcgtctgagagggaaaggctgcggctaggcatacgtactgacgatcgtacgcggcgctccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z