BBa_K314999 1 BBa_K314999 2010-10-01T11:00:00Z 2015-05-08T01:11:55Z To build the mutant proteins, we follow the path of the central dogma. First, we created DNA that contains our mutations. Second, we induced our transformed cells containing the desired DNA to express the mutant proteins. Lastly, we harvested the proteins by lysing open the cells and filtering out non-desired cell components. There are two main obstacles limiting natural CapD as an Anthrax therapeutic. First, natural CapD is a difficult to express dimer, requiring an auto-cleavage to activate. Second, CapD is a better transpeptidase than poly-γ-D-glutamate hydrolase, limiting its Anthrax decapsulating potential. To solve the first problem, we created a circular permuted, monomeric version of CapD that is easy to express and quantify. To improve hydrolysis, we used FoldIt, a computational toolbox, to design active site mutations aimed to increase hydrolysis over transpeptidation. true false _496_ 0 6395 9 Discontinued false To increase the hydrolytic ability of CapD_CP, we made point mutations to the active site. We focused our attention on two types of mutations. First, we created point mutations that can establish hydrogen bondings to a modeled transition state of our substrate in an attempt to lower the activation energy, making hydrolysis more favorable. Second, we mutated the active site into a more open and polar area in an attempt to increase the ease with which water can enter and participate in a hydrolysis reaction. To make these point mutations, we used a computer program named FoldIt to predict how changes in protein structure and composition will affect protein stability. FoldIt provides a 3D representation of a protein's crystal structure that can be manipulated. Manipulation functions include point mutations, insertions, deletions, repacking of side chains (rotamer optimization), and backbone movement, which FoldIt then assesses for stability. This allows the user to quickly interact with a protein and easily predict how mutations will affect a protein. false annotation2081350 1 terminator range2081350 1 20 25 annotation2081349 1 stuff range2081349 1 1 14 BBa_K314999_sequence 1 aaatcttctctcgcgctagagctcgtcagcttcgagcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z