BBa_K315004 1 BBa_K315004 variant forward lox site with 3 base changes in the spacer region (loxm2 forward) 2010-06-15T11:00:00Z 2015-05-08T01:11:55Z We learned about the use of variant lox sites to produce random fluorescent protein expression from the "Brainbow" paper (http://www.nature.com/nature/journal/v450/n7166/full/nature06293.html). We discovered this specific sequence in "Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination" (http://www.ncbi.nlm.nih.gov/pubmed/9714735). The cre-lox system is used for site-specific recombination. Lox sites are 34 bp sequences of DNA that flank coding sequences. When cre recombinase is introduced, it can excise or invert the portions of DNA between two lox sites. If the two lox sites flanking the coding sequence are both forward or both reverse, the coding sequence will be excised, leaving one lox site behind. If the one site is forward and the other reverse, the coding sequence will be inverted. false false _435_ 0 7379 9 It's complicated false In constructing variant lox sites, we looked for the least promiscuous sites - those that had the lowest rates of recombination with other variants. false Tom Shuman BBa_K315004_sequence 1 ataacttcgtataagaaaccatatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z