BBa_K315001 1 BBa_K315001 variant forward lox site with 2 base changes in the spacer region (lox5171) 2010-06-14T11:00:00Z 2015-05-08T01:11:55Z We learned about the use of variant lox sites to produce random fluorescent protein expression from the "Brainbow" paper (http://www.nature.com/nature/journal/v450/n7166/full/nature06293.html). We discovered this specific sequence in "Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination" (http://www.ncbi.nlm.nih.gov/pubmed/9714735). The cre-lox system is used for site-specific recombination. Lox sites are 34 bp sequences of DNA that flank coding sequences. When cre recombinase is introduced, it can excise or invert the portions of DNA between two lox sites. If the two lox sites flanking the coding sequence are both forward or both reverse, the coding sequence will be excised, leaving one lox site behind. If the one site is forward and the other reverse, the coding sequence will be inverted. false false _435_ 0 7372 9 It's complicated false In constructing variant lox sites, we looked for the least promiscuous sites - those that had the lowest rates of recombination with other variants. false Nitya Rao annotation2070871 1 Arm (Inverted Repeat) range2070871 1 22 34 annotation2070870 1 Spacer Region range2070870 1 14 21 annotation2070869 1 Arm (Inverted Repeat) range2070869 1 1 13 BBa_K315017 1 BBa_K315017 pTet + lox5171 Forward 2010-07-08T11:00:00Z 2015-05-08T01:11:55Z We created this part as one step in our project. This a promoter followed by a variant lox site. false false _435_ 0 7372 9 Not in stock false This a good construct to begin when attempting to test how variant lox sites recombine. false Nitya Rao component2072781 1 BBa_K315001 component2072773 1 BBa_R0040 annotation2072773 1 BBa_R0040 range2072773 1 1 54 annotation2072781 1 BBa_K315001 range2072781 1 63 96 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_K315001_sequence 1 ataacttcgtataatgtgtactatacgaagttat BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K315017_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataatgtgtactatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z